View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0364_low_2 (Length: 339)
Name: NF0364_low_2
Description: NF0364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0364_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 118 - 243
Target Start/End: Complemental strand, 30417298 - 30417173
Alignment:
| Q |
118 |
aacctgtgttgcctttgctttgatcaattccttttcaaatattaatgttgttgttgttatccagggagacattccactgcagggagacttctctgctgaa |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30417298 |
aacctgtgctgcctttgctttgatcaattccttttcaaatattaatgttgttgttgttatccagggagacattccactgcagggagacttctctgctgaa |
30417199 |
T |
|
| Q |
218 |
catatgatattcggtggtgggttttc |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30417198 |
catatgatattcggtggtgggttttc |
30417173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 915 times since January 2019
Visitors: 3072