View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0364_low_20 (Length: 213)

Name: NF0364_low_20
Description: NF0364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0364_low_20
NF0364_low_20
[»] chr5 (1 HSPs)
chr5 (106-197)||(6222427-6222518)


Alignment Details
Target: chr5 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 106 - 197
Target Start/End: Original strand, 6222427 - 6222518
Alignment:
106 agtatcataggttttgacggcggtgagagacggaaagataccggaattctgtgggtgtgtggctaagttgacggtggcgaaggtgccactac 197  Q
    ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6222427 agtatcagaggttttgactgcggtgagagacggaaagataccggaattctgtgggtgtgtggctaagttgacggtggcgaaggtgccactac 6222518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1533 times since January 2019
Visitors: 3089