View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0364_low_3 (Length: 336)
Name: NF0364_low_3
Description: NF0364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0364_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 87 - 265
Target Start/End: Original strand, 40751831 - 40752009
Alignment:
| Q |
87 |
aaaattccaagaggcaagagaactagaaggtgtattatcatagaatcttccattctcataatcaattcttgtggtgtaagggaaattaagtatagaggag |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40751831 |
aaaattccaagaggcaagagaactagaaggtgtattatcatagaatcttccattctcatatccaattcttgtggtgtaagggaaattaagtatagaggag |
40751930 |
T |
|
| Q |
187 |
ttagaaaaaacttcttgaaaacttctcttgccacataacttggattgttccctttgttttctagccattataacatgcc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40751931 |
ttagaaaaaacttcttgaaaacttctcttgccacataacttggattgttccctttgttttctagccattataacatgcc |
40752009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 598 times since January 2019
Visitors: 3061