View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365-Insertion-12 (Length: 167)
Name: NF0365-Insertion-12
Description: NF0365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0365-Insertion-12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 9e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 9e-87
Query Start/End: Original strand, 6 - 167
Target Start/End: Complemental strand, 46894323 - 46894162
Alignment:
| Q |
6 |
caatacgaatcctctaggcgatgatagccttctcagacagtttgagttagaagaagaggcagaatccgatttgctctgtgacattgatggatgcaaagct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894323 |
caatacgaatcctctaggcgatgatagccttctcagacagtttgagttagaagaagaggcagaatccgatttgctctgtgacattgatggatgcaaagct |
46894224 |
T |
 |
| Q |
106 |
gggaatagtacatgtagtagcttgattttggaaaaagaacattcaccaatcatgccttgcga |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894223 |
gggaatagtacatgtagtagcttgattttggaaaaagaacattcaccaatcatgccttgcga |
46894162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University