View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365-Insertion-15 (Length: 51)
Name: NF0365-Insertion-15
Description: NF0365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0365-Insertion-15 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 44; Significance: 6e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 6e-17
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 45712438 - 45712481
Alignment:
Q |
8 |
tcgacgcctcctcatttagcggaaacgcacttctatgtgggcct |
51 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45712438 |
tcgacgcctcctcatttagcggaaacgcacttctatgtgggcct |
45712481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 648 times since January 2019
Visitors: 3063