View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365-Insertion-16 (Length: 100)
Name: NF0365-Insertion-16
Description: NF0365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0365-Insertion-16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 48; Significance: 4e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 4e-19
Query Start/End: Original strand, 8 - 73
Target Start/End: Original strand, 3597361 - 3597426
Alignment:
| Q |
8 |
gatatagtacttgatcttgcgcttatccaacaatcacacattgattaacttgtaaccrtccagagg |
73 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||| |||||||||||| |||||||| |
|
|
| T |
3597361 |
gatatagtacttgatcttgcgcttatccgaaaatcacacattggttaacttgtaactatccagagg |
3597426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 4e-16
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 13363214 - 13363268
Alignment:
| Q |
8 |
gatatagtacttgatcttgcgcttatccaacaatcacacattgattaacttgtaa |
62 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||| ||||||||||| |
|
|
| T |
13363214 |
gatatagtacttgatcttgggcttatccaacaatcacatattggttaacttgtaa |
13363268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University