View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365-Insertion-3 (Length: 712)
Name: NF0365-Insertion-3
Description: NF0365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0365-Insertion-3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 3e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 195 - 270
Target Start/End: Complemental strand, 10511691 - 10511616
Alignment:
| Q |
195 |
ataataccctttcattagttgccttcccatcaattttgagcctgccttctcatctcaggcagttaagaatggtggt |
270 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| ||||||||||| |
|
|
| T |
10511691 |
ataataacctttcattagttgccttcccatcaattttgagcctaccttctcatctgaggcagttgagaatggtggt |
10511616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 2e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 62 - 173
Target Start/End: Original strand, 11171662 - 11171776
Alignment:
| Q |
62 |
agaggaagagaagttcatgaatcttatttgacgaaaatgggg---gaaatagtaacacaattcaattaaataagaggcacgactcaacatatgatatgaa |
158 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||| | |||||||| || ||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
11171662 |
agagaaagagaagttcatagatcttatttgacgaaaatggagaaaaaaatagtagcatgattcaatcgaataagaggcacgactcaacatatgatatgta |
11171761 |
T |
|
| Q |
159 |
atatgctttttataa |
173 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
11171762 |
atatgctttttataa |
11171776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 76
Target Start/End: Original strand, 11171591 - 11171646
Alignment:
| Q |
21 |
aattgatgaagcacctatcatgattggatgaagccaatcttagaggaagagaagtt |
76 |
Q |
| |
|
||||||||||| ||||||||| | ||||||||||||||||||| |||||||||| |
|
|
| T |
11171591 |
aattgatgaagtgtctatcatgaattgatgaagccaatcttagagaaagagaagtt |
11171646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 449 times since January 2019
Visitors: 3060