View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365-Insertion-6 (Length: 222)
Name: NF0365-Insertion-6
Description: NF0365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0365-Insertion-6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 8 - 209
Target Start/End: Complemental strand, 1625576 - 1625368
Alignment:
| Q |
8 |
gaatttgggctattttgagtgttgggaaattgcaggttttgtgttggaacttcggtttcaaatgaggttttgattgctggaaatttttgtgttgaaaatt |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1625576 |
gaatttcggctattttgagtgttgggaaattgcaggttttgtgttggaacttcggttttagatgaggttttgattgctggaaatttttgtgttgaaaatt |
1625477 |
T |
|
| Q |
108 |
g-------ttgggggattttgatgaacatcggcccctttgtgagtttagaaaattgaagttttcttgtgaattttcggccgtgtttttgtaggtttatgc |
200 |
Q |
| |
|
| |||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1625476 |
gttgaaaattgggggattttgatgaatttcggcccctttgtgcgtttagaaaattgaagttttcttgtgaattttcggctgtgtttttgtaggtttatgc |
1625377 |
T |
|
| Q |
201 |
gtctgtgaa |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
1625376 |
gtctgtgaa |
1625368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 870 times since January 2019
Visitors: 3069