View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365_1D_high_2 (Length: 479)
Name: NF0365_1D_high_2
Description: NF0365_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0365_1D_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 23 - 464
Target Start/End: Original strand, 15343965 - 15344421
Alignment:
| Q |
23 |
atacaacacctcagtttgataatgggaacacagggattggaaattctgcgcttttgcacaactcttttgaactgttgtcatctgattctgaggccaatca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15343965 |
atacaacacctcagtttgataatgggaacacagggattggaaattctgcgcttttgcaaaacttttttgaactgttgtcatctgattctgaggccaatca |
15344064 |
T |
 |
| Q |
123 |
tggggaggctgatatgaccatttatgcttccactgcagagcagttggttgatacccggatggaaagtttggatgctcctttagagttagcttctaaccag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15344065 |
tggggaggctgatatgaccatttatgcttccactgcagagcagttggttgatacccggatggaaagtttggatgctcctttagagttagcttctaaccag |
15344164 |
T |
 |
| Q |
223 |
atgggaatattggatgttccttt-aatattggatgttcct--------------tttaaggcaccctgttcttcggaaaccaggcccttaaacaatagtg |
307 |
Q |
| |
|
||||||||||||||||||||||| || | || |||| | ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15344165 |
atgggaatattggatgttcctttaaagactgcctgtttgttgactgacacatgttttaaggcaccttgttcttcggaaaccaggcccttaaacaatagtg |
15344264 |
T |
 |
| Q |
308 |
ttacttctgtgtctgcccctaaggctttggatccagctttagttgctaattgggcagctactcctgtgttgacaccaacttgtttccctactcctatcac |
407 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
15344265 |
ttacttctgtgtctgcccctaaggctttcgatccagctttagttgctaattgggcagctactcctgtgttgacaccagcttgtttccctattcctatcac |
15344364 |
T |
 |
| Q |
408 |
ctccaattatgagtttttgggcatggataagcgacctcccacaacccctgatgtcca |
464 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15344365 |
ctccaattatgagtttttgggcatggataagcgacctcccacaaccccttatgtcca |
15344421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University