View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365_1D_high_5 (Length: 276)
Name: NF0365_1D_high_5
Description: NF0365_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0365_1D_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 5 - 225
Target Start/End: Complemental strand, 23332815 - 23332595
Alignment:
Q |
5 |
gcgggctggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatc |
104 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
23332815 |
gcgggatggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatc |
23332716 |
T |
 |
Q |
105 |
gcagagagatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttct |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
23332715 |
gcagagagatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttct |
23332616 |
T |
 |
Q |
205 |
atcgctcattcgtccacatat |
225 |
Q |
|
|
|||||||||||||||| |||| |
|
|
T |
23332615 |
atcgctcattcgtccatatat |
23332595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 220 - 262
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
Q |
220 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
262 |
Q |
|
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23322331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 220 - 262
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
Q |
220 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtc |
262 |
Q |
|
|
||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23332498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 895 times since January 2019
Visitors: 3145