View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365_1D_low_11 (Length: 235)
Name: NF0365_1D_low_11
Description: NF0365_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0365_1D_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 23 - 217
Target Start/End: Complemental strand, 34765908 - 34765703
Alignment:
Q |
23 |
atgacatagcttgtgaccaagtaaatactaagatggaaggatcaatgaggtt---------cgaagaaaaattgatgatcttaaaaa--tgtgtgtttga |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
T |
34765908 |
atgacatagcttgtgaccaagtaaatactaagatggaaggatcaatgaggttaatgtctttcgaagaaaaattgatgatcttaaaaaaatgtgtgtttga |
34765809 |
T |
 |
Q |
112 |
gtttcttcgttgaattctttcaaagaaaaatactttagagattaaatctatgcaactacactagtcatatatgatttacaccaaaagtattctttttctg |
211 |
Q |
|
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34765808 |
gtttcttcgctgaattctttcaaagaaaaatacttgagagattaaatctatgcaactacactagtcatatatgatttacaccaaaagtattctttttctg |
34765709 |
T |
 |
Q |
212 |
tgattt |
217 |
Q |
|
|
|||||| |
|
|
T |
34765708 |
tgattt |
34765703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1012 times since January 2019
Visitors: 3160