View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365_1D_low_14 (Length: 220)
Name: NF0365_1D_low_14
Description: NF0365_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0365_1D_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 24 - 207
Target Start/End: Original strand, 995932 - 996116
Alignment:
Q |
24 |
gggaagaggtaaagaatcatggcaacagaaatttaagcaatgttcttcnnnnnnn-gaaatttatggaatgtgatgtgatgttggtgaaagttttctctt |
122 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
995932 |
gggacgaggtaaagaatcatggcaacagaaatttaagcaatgttcttcaaaaaaaagaaatttatgcaatgtgatgtgatgttggtgaaagttttctctt |
996031 |
T |
 |
Q |
123 |
ttatgttttactaacttctctagttttggcaattgggaacatgcaagcatcacattgccttattgacttatatctaacatagtaa |
207 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
996032 |
ttatgttttactaacttctctagttttggcaattgcgaacatgcaagcatcatattgccttattgacttatatctaacatagtaa |
996116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University