View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365_2D_low_12 (Length: 267)
Name: NF0365_2D_low_12
Description: NF0365_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0365_2D_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 39399116 - 39399354
Alignment:
Q |
1 |
cattatatatattaatattacgaggaggacgcgatttagaactcaaaattttggcccaacataaatagatagaaaagtgagtgaggcagtttattgcaaa |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
39399116 |
cattatatatattaatattacgaggaggacgcgatttagaactcaaaattttggcccaacataaagagatagaaaagtgagtgaggcagtttattgcaaa |
39399215 |
T |
 |
Q |
101 |
agattaggtcaagaatggagaaggagaaagaggtgatggaggatcgccgccgacaccgacgcccggttatggttgtgaaggtaagtcaagaacatgtttg |
200 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39399216 |
agattaggtcaaaaatggagaaggagaaagaggtgatggaggatcgccg------acgacgcccggttatggttgtgaaggtaagtcaagaacatgtttg |
39399309 |
T |
 |
Q |
201 |
tcatctgcgtactttctttgatgtggagcaaatcatcgttatgaa |
245 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39399310 |
tcatctgcgtactttctttgatgtggagcaaatcatcgttatgaa |
39399354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 172 - 245
Target Start/End: Original strand, 39879189 - 39879262
Alignment:
Q |
172 |
gttgtgaaggtaagtcaagaacatgtttgtcatctgcgtactttctttgatgtggagcaaatcatcgttatgaa |
245 |
Q |
|
|
|||||||| || ||||| ||||||||||||| ||||||||||||||| || ||||||| |||| |||| |||| |
|
|
T |
39879189 |
gttgtgaatgttcgtcaacaacatgtttgtcagctgcgtactttctttcatttggagcagatcagcgttttgaa |
39879262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 172 - 245
Target Start/End: Original strand, 40411894 - 40411967
Alignment:
Q |
172 |
gttgtgaaggtaagtcaagaacatgtttgtcatctgcgtactttctttgatgtggagcaaatcatcgttatgaa |
245 |
Q |
|
|
|||||||| || ||||| ||||||||||||| ||||||||||||||| || ||||||| |||| |||| |||| |
|
|
T |
40411894 |
gttgtgaatgttcgtcaacaacatgtttgtcagctgcgtactttctttcatttggagcagatcagcgttttgaa |
40411967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 241
Target Start/End: Complemental strand, 25913000 - 25912944
Alignment:
Q |
185 |
gtcaagaacatgtttgtcatctgcgtactttctttgatgtggagcaaatcatcgtta |
241 |
Q |
|
|
||||| ||||||||||||| ||||||||||||||| || ||||||| |||| ||||| |
|
|
T |
25913000 |
gtcaacaacatgtttgtcaactgcgtactttctttcatttggagcagatcagcgtta |
25912944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 960 times since January 2019
Visitors: 3153