View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365_2D_low_13 (Length: 263)
Name: NF0365_2D_low_13
Description: NF0365_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0365_2D_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 20 - 213
Target Start/End: Complemental strand, 30504466 - 30504271
Alignment:
Q |
20 |
ctccagatgtagcggggctcatgttcttgaatttctccggtacatgccaacnnnnnnn-tatgaa-tgagtttctaattcagtctttattttttataaac |
117 |
Q |
|
|
||||||||||||||| |||||||| |||||||||||||||||||| ||||| |||||| ||||| ||||||||| |||||||||||||| ||| |
|
|
T |
30504466 |
ctccagatgtagcggtgctcatgtgcttgaatttctccggtacataccaacaaaaaaaatatgaaatgagtctctaattcaatctttattttttattaac |
30504367 |
T |
 |
Q |
118 |
aagttttggtggaagagaaatatttagaagtagagattgaatcctgaaacctggaacatctcttgttctttgataaggaaataagtgtacaatttc |
213 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
30504366 |
aagttttggtggaagagaaatatttagaagtagagattgaatcctgaaacctggaacatctcttgttctttgataaggaaataagtgtagaatttc |
30504271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University