View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365_2D_low_17 (Length: 230)
Name: NF0365_2D_low_17
Description: NF0365_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0365_2D_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 11 - 208
Target Start/End: Complemental strand, 4882824 - 4882627
Alignment:
| Q |
11 |
atggacatcaataggtgtagtaaaacaggttcaatctgtcagaccagtttgtttagtctgctatttttgaccagatgaacttccattttgaacttgtcgc |
110 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| || | |||||||||| | | ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4882824 |
atggacatcaataggtgtagtaaaataggttcaatctgtcggatcggtttgtttagcccgttatttttgaccagatgaacttccattttgaacttgccgc |
4882725 |
T |
 |
| Q |
111 |
ttttagttgactcgtcccattaaacttgttgaaaaaatggggtggggcagagacagggccgacctgcatgccaactcgtcaacctgcaatttatttaa |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4882724 |
ttttagttgactcgtcccgttaaacttgttgaaaaaatggggtggggcagagacagggccgacctgcatgccaactcgtcaacctgcaatttatttaa |
4882627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University