View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365_2D_low_22 (Length: 201)
Name: NF0365_2D_low_22
Description: NF0365_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0365_2D_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 79 - 180
Target Start/End: Original strand, 7333844 - 7333945
Alignment:
Q |
79 |
tgtgagagagaaactttgaaagagtgtgtggaagaatgttgtggaccatagggtacttggtttgtctgttattgtcggaggagcgtgttctgtttcttaa |
178 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
7333844 |
tgtgagagagaaactttgaaagagtgtgtggaagaatgttgtggaccatagggtacttggtttgtctgttattgtcggagaagcgtgttctgtttcttaa |
7333943 |
T |
 |
Q |
179 |
gt |
180 |
Q |
|
|
|| |
|
|
T |
7333944 |
gt |
7333945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 79 - 183
Target Start/End: Complemental strand, 7299832 - 7299728
Alignment:
Q |
79 |
tgtgagagagaaactttgaaagagtgtgtggaagaatgttgtggaccatagggtacttggtttgtctgttattgtcggaggagcgtgttctgtttcttaa |
178 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
7299832 |
tgtgagagagaaactttcaaagagtgtgtggaagaatgttggggaccatagggtacttggtttgtctgttattgtcggaggagcgtgttctgtttcgtaa |
7299733 |
T |
 |
Q |
179 |
gtgtt |
183 |
Q |
|
|
||||| |
|
|
T |
7299732 |
gtgtt |
7299728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 7340629 - 7340697
Alignment:
Q |
102 |
gtgtgtggaagaatgttgtggaccatagggtacttggtttgtctgttattgtcggaggagcgtgttctg |
170 |
Q |
|
|
|||||||||| ||||||| | |||||||| || |||||| ||||||||||||| ||||||| ||||||| |
|
|
T |
7340629 |
gtgtgtggaataatgttgggaaccataggatatttggttcgtctgttattgtcagaggagcatgttctg |
7340697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 6 - 39
Target Start/End: Complemental strand, 7299905 - 7299872
Alignment:
Q |
6 |
tttggtgtttgtgagattttggtgatgaaaaatg |
39 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| |
|
|
T |
7299905 |
tttgttgtttgtgagattttggtgatgaaaaatg |
7299872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 6 - 39
Target Start/End: Original strand, 7333771 - 7333804
Alignment:
Q |
6 |
tttggtgtttgtgagattttggtgatgaaaaatg |
39 |
Q |
|
|
|||| ||||||||||||||||||||||||||||| |
|
|
T |
7333771 |
tttgttgtttgtgagattttggtgatgaaaaatg |
7333804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 971 times since January 2019
Visitors: 3155