View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0365_2D_low_3 (Length: 458)
Name: NF0365_2D_low_3
Description: NF0365_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0365_2D_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 407; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 407; E-Value: 0
Query Start/End: Original strand, 1 - 441
Target Start/End: Complemental strand, 5265435 - 5264991
Alignment:
| Q |
1 |
acttcggaagaccggtgatgttgataaactgagaaaagcaagggaagttatgactgaaatctttccattgaccccttccttgtggcagcagtggattaaa |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5265435 |
acttcggaaaaccggtgatgttgataaactgagaaaagcaagggaagttatggctgaaatctttccattgaccccttccttgtggcagcagtggattaaa |
5265336 |
T |
|
| Q |
101 |
gatgagctttctctcaccaccgccaagaatgacactttctctaccgttgttaagctttatgaatgcgcggtgtttgattatctggtaagtatgttctgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5265335 |
gatgagctttctctcaccaccgccaataatgacactttctctaccgttgttaagctttatgaatgcgcggtgtttgattatctggtaagtatgttctgtt |
5265236 |
T |
|
| Q |
201 |
tgttagaatattagttttttgagtttacattgttg---atatttcctgttgatgcacattaga-taccaggttattgagccttttgttataattgagcta |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5265235 |
tgttagaatattagttttttgagtttacattgttgattatatttcctgttgatgcacattagattaccaggttattgagccttttgttataattgagcta |
5265136 |
T |
|
| Q |
297 |
agagtgcgtttaatttgctaaaaaataataggattagactcgacaacattttttgcagtaccttgtttgatttagaatattagttgttttgagtagtagc |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5265135 |
agagtgcgtttaatttgctaaaaaataataggattagactcgacaacattttttgcagtaccctgtttgatttagaatattagttgttttgagtagtagc |
5265036 |
T |
|
| Q |
397 |
ggaaagatgagtgcctgttcgtcctcttttttatttcccttgatg |
441 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5265035 |
ggaaagatgagtgcctgttcgtcctcttttttatttcccttgatg |
5264991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 265 - 298
Target Start/End: Original strand, 42408433 - 42408466
Alignment:
| Q |
265 |
aggttattgagccttttgttataattgagctaag |
298 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
42408433 |
aggttattgaaccttttgttataattgagctaag |
42408466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 871 times since January 2019
Visitors: 3135