View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_high_24 (Length: 251)
Name: NF0367_high_24
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0367_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 36717012 - 36717232
Alignment:
Q |
1 |
aatgtttgtctgtcatattaatcgtgttaaggaaaatgatatcttcactccggcaatagatggatctattctgcctggggtcacacgaaaatccatcata |
100 |
Q |
|
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36717012 |
aatgtttgtctttcatattaatcttgttaaggaaaatgatatcttcactccggcaatagatggatctattctgcctggggtcacacgaaaatccatcata |
36717111 |
T |
 |
Q |
101 |
gaaatcgccattgatttgggttataaggtatttatgtttccctcccaatgtgtgccattattttctacaaatttacaatatagatgattaatgatttatg |
200 |
Q |
|
|
|| || ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36717112 |
gacattgccattgatttgggttataaggtatttatttttccctcccaatgtttgccattattttctacaaatttacaatatagatgattaatgatttatg |
36717211 |
T |
 |
Q |
201 |
gctataaacttacaaaagaaa |
221 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
36717212 |
gctataaacttacaaaagaaa |
36717232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University