View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_high_27 (Length: 249)
Name: NF0367_high_27
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0367_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 41859049 - 41858830
Alignment:
| Q |
1 |
aaagcaaaacatccagaaatcaaaaaggacagaaaattgttgaaacatctcattcactgtgcatttacacnnnnnnnnntaggataaaactcaaacaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
41859049 |
aaagcaaaacatccagaaatcaaaaaggacagaaaattgttgaaacatctcattcactatgcatttacacaaaaaaaaatagaataaaactcaaacaaca |
41858950 |
T |
|
| Q |
101 |
taaattattatatttcggaaactccatatccagctcaataaccgactaaaccggcgtccagtactagcagaggctaaatacttaggtactggcccaacgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41858949 |
taaattattatatttcggaaactccatatccagctcaataaccgactaaaccggcgtc---tactagcagaggctaaatacttaggtactggcccaacgg |
41858853 |
T |
|
| Q |
201 |
ccaacacaggaattgttggtact |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41858852 |
ccaacacaggaattgttggtact |
41858830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1329 times since January 2019
Visitors: 3081