View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0367_high_28 (Length: 219)

Name: NF0367_high_28
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0367_high_28
NF0367_high_28
[»] chr6 (1 HSPs)
chr6 (1-114)||(28847412-28847525)


Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 28847412 - 28847525
Alignment:
1 ctttttgccagtgatttcttcatcatcataactatcatcattgaaataagtcttacattgtgattgatgatgattacgcttcatcttgagaaagtgagat 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||  |||| |||||||||||||||||||||||||||||||||||||||||||    
28847412 ctttttgccagcgatttcttcatcatcataactatcatcattgaaataagcattaccttgtgattgatgatgattacgcttcatcttgagaaagtgagat 28847511  T
101 cttcggtgaccacc 114  Q
    ||||||||||||||    
28847512 cttcggtgaccacc 28847525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1467 times since January 2019
Visitors: 3087