View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_high_30 (Length: 207)
Name: NF0367_high_30
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0367_high_30 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 9e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 76 - 207
Target Start/End: Original strand, 27822220 - 27822351
Alignment:
| Q |
76 |
catagggtatcatggtttaatttattggattctaattgatgtaggtatacaacattggaaagaaggtgtggacaggaaagggtgaagaacaagaagaggg |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27822220 |
catagggtatcatggtttaatttattggattctaattgatgtaggtatacaacattggaaagaaggtgtggacaggaaagggtgaagaacaagaagaggg |
27822319 |
T |
 |
| Q |
176 |
taaaaagaagtttatagaatgcttgaagactc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27822320 |
taaaaagaagtttatagaatgcttgaagactc |
27822351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 76 - 207
Target Start/End: Original strand, 27826158 - 27826290
Alignment:
| Q |
76 |
catagggtatcatggtttaattta-ttggattctaattgatgtaggtatacaacattggaaagaaggtgtggacaggaaagggtgaagaacaagaagagg |
174 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||| ||| |||| | |||| |||||||| |||||||||||| || | |
|
|
| T |
27826158 |
catagggtatcatggcttaattttgttggattctaattgatgtaggtatacagcattcgaaggaagctatggaaaggaaaggttgaagaacaagaggaag |
27826257 |
T |
 |
| Q |
175 |
gtaaaaagaagtttatagaatgcttgaagactc |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
27826258 |
gtaaaaagaagtttatagaaggcttgaagactc |
27826290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University