View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_high_32 (Length: 205)
Name: NF0367_high_32
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0367_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 36950006 - 36949899
Alignment:
Q |
1 |
ggtggcagaacaatatatgttacatggaatgcctagtagatcagatatgcaacagcttattaatgtcaatagacacatggtatgttttttctcccttccc |
100 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36950006 |
ggtggcagaaccatatatgttacatggaatgcctagtagatcacatatgcacc---ttattaatgtcaatagacacatggtatgttttttctcccttccc |
36949910 |
T |
 |
Q |
101 |
atctatgcccc |
111 |
Q |
|
|
||||||||||| |
|
|
T |
36949909 |
atctatgcccc |
36949899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 10818104 - 10818188
Alignment:
Q |
27 |
gaatgcctagtagatcagatatgcaacagcttattaatgtcaatagacacatggtatgttttttctcccttcccatctatgcccc |
111 |
Q |
|
|
||||||||||||||||| ||||||||| | |||||||| |||||||||||||||||| |||||||||| ||||| |||||| |
|
|
T |
10818104 |
gaatgcctagtagatcacatatgcaacgtgacaataatgtcactagacacatggtatgtttattctcccttctcatctttgcccc |
10818188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University