View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_high_4 (Length: 611)
Name: NF0367_high_4
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0367_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 294; Significance: 1e-165; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 101 - 413
Target Start/End: Original strand, 43760178 - 43760493
Alignment:
| Q |
101 |
tttgtcgctcctgcgtgcgtgtatgttgttcttcatcttcttctaattgcacttgttgttttttcaatcccaataacctcaaatctcgaggcttgttttg |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43760178 |
tttgtcgctcctgcgtgcgtgtgtgttgttcttcatcttcttctaattgcactttttgttttttcaatcccaataacctcaaatctcgaggcttgttttg |
43760277 |
T |
 |
| Q |
201 |
ttttctcaaagggtgacacgacacaatctctctttcttcttccgccattttctctcgtgtcttgaaccaggg---tactgccagctacaccctcctcttt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43760278 |
ttttctcaaagggtgacacgacacaatctctctttcttcttccgccattttctctcgtgtcttgaaccagggtactactgccagctacaccctcctcttt |
43760377 |
T |
 |
| Q |
298 |
tgctttggttcactgcactttgagttttggacttaagggtgtccttaatagctggagggtcggtgttcaacttgaattttttgtgcttttgcttcacatt |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43760378 |
tgctttggttcactgcactttgagttttggacttaagggtgtccttaatagctggagggtcggtgttcaacttgaattttttgtgcttttgcttcacatt |
43760477 |
T |
 |
| Q |
398 |
cacaagacgggtaccc |
413 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
43760478 |
cacaagacgggtaccc |
43760493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 529 - 589
Target Start/End: Original strand, 43760595 - 43760655
Alignment:
| Q |
529 |
gggatcctaggtttgagtttttcacaacatgcaaaaacctcttgttattggttcttttctg |
589 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43760595 |
gggatcctaggtttgagtttttcacaacatgcaaaaacctcttgttattggttcttttctg |
43760655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University