View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_14 (Length: 387)
Name: NF0367_low_14
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0367_low_14 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 90 - 387
Target Start/End: Original strand, 34451898 - 34452193
Alignment:
| Q |
90 |
aacaatagttttgtagctttagtttgttgcattgcattgtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgt |
189 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34451898 |
aacaatagttctgtagctttagtttgttgcattgcatggtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgt |
34451997 |
T |
 |
| Q |
190 |
catatgatgggaacagtccnnnnnnngcaacctacagtattaccctttcttctttaattagatctttcatcatcaattcacaaagatcaaacnnnnnnnn |
289 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
34451998 |
catatgatgggaacagtccaacaaaagcaacctacagtattaccttttcttctttaatcagatctttcatcatcaattcacaaagatcaagc--tttttt |
34452095 |
T |
 |
| Q |
290 |
nnngcatcacaataacatcctttccttgtctcattttattttgtggatgaaatgaatctttaatccttttttcttcaataagcaatgaatcttaatct |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34452096 |
tttgcatcacaataacatcctttccttgtctcattttattttgtggatgaaatgaatctttaatccttttttcttcaataagcaatgaatcttaatct |
34452193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University