View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_17 (Length: 352)
Name: NF0367_low_17
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0367_low_17 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 56 - 352
Target Start/End: Complemental strand, 44915869 - 44915573
Alignment:
| Q |
56 |
aaaaatattacaaaataagagttgtagtgttcctgatacaacgcagaatgtctgagcagatgatagaaatgtaaaaagcattctcagcttctcaatatcc |
155 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44915869 |
aaaaaaattacaaaataagagttgtagtgttcctgatacaatgcagaatgtctgagcagatgatagaaatgtaaaaagcattctcagcttctcaatattc |
44915770 |
T |
|
| Q |
156 |
atgcactatttaataattgatactgaaagaaaaagctagcactaaattgttgggatccaattacttggagaaatgcgacaccagtaataacactatcagg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44915769 |
atgcactatttaataattgatactgaaagaaaatgctagcactaaattgttgggatccaattacttggagaaatgcgacactagtaataacactatcagg |
44915670 |
T |
|
| Q |
256 |
agaagcaactccactcattgttggggtcttgggaagggaattagattatccattttgcagctaggtgtgtctgttgttgcctttgtagatggagttc |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44915669 |
agaagcaactccactcattgttggggtcttgggaagggaattagattatccattttgcagctaggtgtgtctgttgttgcctttgtagatggagttc |
44915573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 227 - 341
Target Start/End: Complemental strand, 7749481 - 7749368
Alignment:
| Q |
227 |
aatgcgacaccagtaataacactatcaggagaagcaactccactcattgttggggtcttgggaagggaattagattatccattttgcagctaggtgtgtc |
326 |
Q |
| |
|
|||| |||||||||| |||||||| |||||||||||||||||||||||| || |||||||||||||||||||| | ||| ||||||||||||||||| | |
|
|
| T |
7749481 |
aatgggacaccagtactaacactagcaggagaagcaactccactcattgcaggtgtcttgggaagggaattaga-tctccgttttgcagctaggtgtgcc |
7749383 |
T |
|
| Q |
327 |
tgttgttgcctttgt |
341 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7749382 |
tgttgttgcctttgt |
7749368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 237 - 340
Target Start/End: Complemental strand, 2339356 - 2339254
Alignment:
| Q |
237 |
cagtaataacactatcaggagaagcaactccactcattgttggggtcttgggaagggaattagattatccattttgcagctaggtgtgtctgttgttgcc |
336 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| | || ||||||||||||||||| ||||||||||| |
|
|
| T |
2339356 |
cagtaaaaacactatcaggagaagcaactccactcattgatggggtcttgggaaaggaattaga-tccccgttttgcagctaggtgtgcctgttgttgcc |
2339258 |
T |
|
| Q |
337 |
tttg |
340 |
Q |
| |
|
|||| |
|
|
| T |
2339257 |
tttg |
2339254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 27 - 63
Target Start/End: Original strand, 35341256 - 35341292
Alignment:
| Q |
27 |
catcatacaccaaggaccaattgcacatgaaaaatat |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35341256 |
catcatacaccaaggaccaattgcacatgaaaaatat |
35341292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 759 times since January 2019
Visitors: 3065