View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_18 (Length: 349)
Name: NF0367_low_18
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0367_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 4e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 77 - 260
Target Start/End: Original strand, 40166707 - 40166890
Alignment:
| Q |
77 |
agcatagggttttaaagctactagtatttcaattttgtttgtattctataacggttaatgatatacatctatagggaaagcaaatagaacgtaaaatggg |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40166707 |
agcatagggttttaaagctactagtatttcaattttgtttgtattctataacggttaatgatatacatctacagggaaagcaaatagaacgtaaaatggg |
40166806 |
T |
|
| Q |
177 |
agctgattattattgcttataaatgaatcaaataaagcacatgtaaccgaagaagaaaaatatcaatcaaaatttggtcctaaa |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40166807 |
agctgattattattgcttataaatgaatcaaataaagcacatgtaaccgaagaagaaaaatatcaatcaaaatttggtcctaaa |
40166890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1501 times since January 2019
Visitors: 3089