View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_26 (Length: 308)
Name: NF0367_low_26
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0367_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 86 - 238
Target Start/End: Complemental strand, 42622810 - 42622658
Alignment:
| Q |
86 |
atccaaacatgctttacatcttatcttgagtagatttttatattgatttaattttaattaattacagatcaactatcgtggtcaaaacaatgtgattatt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42622810 |
atccaaacatgctttacatcttatcttgagtagatttttatattgatttaattttaattaattacagatcaactatcgtggtcaaaacaatgtgattatt |
42622711 |
T |
 |
| Q |
186 |
cagacaatcaggaccaaaacgacgaggacaatcgtcgtttggctattgtgcct |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42622710 |
cagacaatcaggaccaaaacgaggaggacaatcgtcgtttggctattgtgcct |
42622658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University