View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_28 (Length: 301)
Name: NF0367_low_28
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0367_low_28 |
 |  |
|
[»] scaffold0221 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0221 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0221
Description:
Target: scaffold0221; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 167 - 203
Target Start/End: Original strand, 25160 - 25196
Alignment:
Q |
167 |
gaacaagtagagtatactagggcgcttgagagaacca |
203 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
25160 |
gaacaagtagagtatactagggcgcttgagagaacca |
25196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 144
Target Start/End: Original strand, 11593117 - 11593153
Alignment:
Q |
108 |
cttcgaattgggagggcgatcctcccggtgaactgac |
144 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||| |
|
|
T |
11593117 |
cttcgaattgggagggcgatcctcccaatgaactgac |
11593153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1175 times since January 2019
Visitors: 3076