View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_29 (Length: 292)
Name: NF0367_low_29
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0367_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 4039243 - 4039004
Alignment:
Q |
1 |
ttcatttcatcctccttgcagccattgttttcggttaaacacgattcaaaactactcgaaatgtaatcgaattgtgcagtgtcattgatcaattcattgt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4039243 |
ttcatttcatcctccttgcagccattgttttcggttaaacacgattcaaaactactcgaaatgtaatcgaattgtgcagtgtcattgatcaattcattgt |
4039144 |
T |
 |
Q |
101 |
tgcttgtgctataatcctcatggtcattaaggaaatcagtgaactgatcaattgagaaatcttttgataattctccatatgcatccacttgttgttgcat |
200 |
Q |
|
|
|||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
4039143 |
tgcttgtgctataatcctcatgatcattgaggaaatcagtgaattgatcaattgagaaatcttttgatacttctccatatgcatccacttgttgttgcat |
4039044 |
T |
 |
Q |
201 |
ctcctgacgatcctgatcattggctcgttgttgctcccta |
240 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
4039043 |
ctcctgacgatcgtgatcattggctcgttgttgctcccta |
4039004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University