View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_30 (Length: 292)
Name: NF0367_low_30
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0367_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 30 - 283
Target Start/End: Complemental strand, 43121125 - 43120872
Alignment:
Q |
30 |
gtttgtgttagtaatattcttacctctttatagacgttttggatcaccaaaacaagatcctattccacccatttttgtcctcaattcaatgtacatttca |
129 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43121125 |
gtttatgttagtaatattcttacctctttatagacgttttggatcaccaaaacaagaccctattccacccatttttgtcctcaattcaatgtacatttca |
43121026 |
T |
 |
Q |
130 |
aatttcaccgtgggaacaaaaggactcgccgcgacgtgggatgccaaatttacagtcagaaatacaaatgtctcatccatatattttagaaccattgatt |
229 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43121025 |
aatttcaccgtaggaacaaaaggactcgccgcgacgtgggatgccaaatttacagtcagaaatacaaatgtctcatccatatattttagaaccattgatt |
43120926 |
T |
 |
Q |
230 |
tcacaatattttataaacaaaatctagaaaatgctctttcaatgacgtcttcat |
283 |
Q |
|
|
|||||||||||||||||||||||| |||| |||||||||||| ||||||||||| |
|
|
T |
43120925 |
tcacaatattttataaacaaaatccagaagatgctctttcaacgacgtcttcat |
43120872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1573 times since January 2019
Visitors: 3090