View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_32 (Length: 288)
Name: NF0367_low_32
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0367_low_32 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 24 - 288
Target Start/End: Original strand, 37757069 - 37757333
Alignment:
| Q |
24 |
tcatcatcttctcatgtaggcttactttgtaaccatattttaaaaataactacaacatactctactattgtaaccatccaatagaaaatattcactacac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37757069 |
tcatcatcttctcatgtaggcttactttgtaaccatcttttaaaaataactacaacatactctactattgtaaccatccaatagaaaatattcactacac |
37757168 |
T |
 |
| Q |
124 |
taaatattcatcatttcatgaaaaaataacaaattataatgcttgcgttgcaagtttaaaagttagagttaaaaaagttacaagattaaacctttgtgtt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37757169 |
taaatattcatcatttcatgaaaaaatatcaaattataatgcttgcgttgcaagtttaaaagttagagttaaaaaagttaaaagattaaacctttgtgtt |
37757268 |
T |
 |
| Q |
224 |
catcatcatcagcatcatgatactcatcttcatgttcttcctcaataacaggatgaagttcaact |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37757269 |
catcatcatcagcatcatgatactcatcttcatgttcttcctcaataacaggatgaagttcaact |
37757333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University