View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_34 (Length: 281)
Name: NF0367_low_34
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0367_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 43 - 235
Target Start/End: Original strand, 46508842 - 46509034
Alignment:
| Q |
43 |
aatattgattcaactagagcctgcaaaccaacaaaaattaactcagcatatgctaccagcacaagttaatgaaatacataacaatgaagaaaaacaagaa |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46508842 |
aatattgattcaactagagcctgcaaaccaacaaaaattaactcagcatatgctaccagcacaagttaatgaaatacataacaatgaagaaaaacaagaa |
46508941 |
T |
 |
| Q |
143 |
ataagctggattataagagcaactaaactcactaaatttataagacaacaccaaaccaagaccatattcacaaggacaaatcaataatgatga |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46508942 |
ataagctggattataagagcaactaaactcactaaatttataagacaacaccaaaccaagaccatattcacaaggtcaaatcaataatgatga |
46509034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University