View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_36 (Length: 263)
Name: NF0367_low_36
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0367_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 27 - 236
Target Start/End: Original strand, 4556129 - 4556338
Alignment:
| Q |
27 |
cgtcgtaactctgtctcaaaatttctaaaaggtgctattctcttcttcgaaggtggtacctcttcctcaaaagaaaaagaaggtggcaactcactatatg |
126 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
4556129 |
cgtcgtaactctttctcaaaatttctaaaaggtgctattctcttcttcgaaggtggtacctcttcctcaaaagaaaaagaaggtggcaacttactatttg |
4556228 |
T |
 |
| Q |
127 |
gagacttgtaagttggagtaagcttgtccgcagcaagccctcgaggaagaaggataaaagcagcaatgaactttgaaactagcgaggacaggaaaaatga |
226 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||| |||||||||||||||| ||||||| ||||||| |||||| || |
|
|
| T |
4556229 |
gagacttgtaagttggagtaaggttgtacgcagcaagcccttgaggaagaaggataagagcagcaatgaactttaaaactagtgaggacaagaaaaagga |
4556328 |
T |
 |
| Q |
227 |
agccatttta |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
4556329 |
agccatttta |
4556338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 106 - 236
Target Start/End: Original strand, 4539574 - 4539704
Alignment:
| Q |
106 |
aaggtggcaactcactatatggagacttgtaagttggagtaagcttgtccgcagcaagccctcgaggaagaaggataaaagcagcaatgaactttgaaac |
205 |
Q |
| |
|
||||||| |||||||||| | ||| |||||||||||| ||||| |||| ||||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
4539574 |
aaggtggtaactcactatttagaggcttgtaagttggtgtaagtttgtacgcagcaagcccttgaggaagaaggataagagcagcaatgaactttaaaac |
4539673 |
T |
 |
| Q |
206 |
tagcgaggacaggaaaaatgaagccatttta |
236 |
Q |
| |
|
||| ||||||| |||||| |||||||||||| |
|
|
| T |
4539674 |
tagtgaggacaagaaaaaggaagccatttta |
4539704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University