View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_39 (Length: 252)
Name: NF0367_low_39
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0367_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 4 - 241
Target Start/End: Original strand, 20489349 - 20489587
Alignment:
| Q |
4 |
atggtcatggtcatggccatgatgagcatgtatgtacatatacaatctaaccaaccttcctgcgtttatatcattatacagatgaagaataattattaca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
20489349 |
atggtcatggtcatggccatgatgagcatgtatgtagatatacaatctaaccaaccttcctgtgtttatatcattatacagatgaagaataattattaaa |
20489448 |
T |
 |
| Q |
104 |
cagatcccaccataattttgagagcttcaaagtcactc-tttaacaaattaaaagtaattgcttggagggtaatttcttttgactaggattgatttacta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20489449 |
gagatcccaccataattttgagagcttcaaagtcactcttttaacaaattaaaagtaattgcttggagggtaatttcttttgactaggattgatttacta |
20489548 |
T |
 |
| Q |
203 |
tggcccattaatatctcactgcttcctctttaggttcat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20489549 |
tggcccattaatatctcactgcttcctctttaggttcat |
20489587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University