View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_41 (Length: 251)
Name: NF0367_low_41
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0367_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 20489249 - 20489034
Alignment:
Q |
1 |
ccacaatctctaacacaaacttctggtgttaacaccattagaaggattaaagcactgttcccacttacatataccccactttcttctatatggtaacgga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
20489249 |
ccacaatctctaacacaaacttctggtgttaacaccatgagaaggataaaagcactgttcccacttacataaaccccactttcttctatatggtaacgga |
20489150 |
T |
 |
Q |
101 |
gacatgaacaccggacacagacacaatacgtaggcatatgtagctctgtagcacctacagttgttattgaaggcgtgtccagtgtttaacatgtgttggt |
200 |
Q |
|
|
||||||| ||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||||| | ||| ||||||| |
|
|
T |
20489149 |
gacatgagcaccggacacagacacaatacgtagacatatgtagctctgttgcatctacagttgttattgaaggcgtgtccagtgttcaccatatgttggt |
20489050 |
T |
 |
Q |
201 |
atcgaagactgacaca |
216 |
Q |
|
|
|| ||| || |||||| |
|
|
T |
20489049 |
attgaacaccgacaca |
20489034 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University