View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_46 (Length: 239)
Name: NF0367_low_46
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0367_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 7 - 163
Target Start/End: Complemental strand, 36253631 - 36253475
Alignment:
Q |
7 |
gaaaaggaccattttctaggtccttacaatgtggatgaagaccaaatggacaacattcccattgcacttgccgtttctgatgcatcccccgttgtgacgg |
106 |
Q |
|
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36253631 |
gaaaaggaccattttctatgtccatacaatgtggatgaagaccaaatggacaatattcccattgcacttgccgtttctgatgcatcccccgttgtgacgg |
36253532 |
T |
 |
Q |
107 |
tggccatggctgcccccgcagatgacacaaacgcggcaacaaacacagccaccacct |
163 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36253531 |
tggccatggctgcccccgcagatgacacaaacgcggcaacaaacacagccaccacct |
36253475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University