View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0367_low_46 (Length: 239)

Name: NF0367_low_46
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0367_low_46
NF0367_low_46
[»] chr1 (1 HSPs)
chr1 (7-163)||(36253475-36253631)


Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 7 - 163
Target Start/End: Complemental strand, 36253631 - 36253475
Alignment:
7 gaaaaggaccattttctaggtccttacaatgtggatgaagaccaaatggacaacattcccattgcacttgccgtttctgatgcatcccccgttgtgacgg 106  Q
    |||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
36253631 gaaaaggaccattttctatgtccatacaatgtggatgaagaccaaatggacaatattcccattgcacttgccgtttctgatgcatcccccgttgtgacgg 36253532  T
107 tggccatggctgcccccgcagatgacacaaacgcggcaacaaacacagccaccacct 163  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36253531 tggccatggctgcccccgcagatgacacaaacgcggcaacaaacacagccaccacct 36253475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1606 times since January 2019
Visitors: 3090