View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_47 (Length: 239)
Name: NF0367_low_47
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0367_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 3308885 - 3309034
Alignment:
Q |
1 |
caaactagcatatgttttttatgtatacactccgacgagcaaatcataaatcacaaattaaacaactttagtatctggtatctatcatttatctctgac- |
99 |
Q |
|
|
|||| |||||||||||||||||||||||||| || || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3308885 |
caaagtagcatatgttttttatgtatacactgtgaagatcaaatcataaatcacagattaaacaactttagtatctggtatctatcatttatctctgacg |
3308984 |
T |
 |
Q |
100 |
attaacaatcatcttaattgatatattttctgtatatgtattagcacgtt |
149 |
Q |
|
|
|||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
T |
3308985 |
attaacaatcatctcaattgatatattttctatatatgtattagcacgtt |
3309034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University