View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_48 (Length: 239)
Name: NF0367_low_48
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0367_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 62 - 148
Target Start/End: Complemental strand, 3308850 - 3308764
Alignment:
| Q |
62 |
atatactccaaaacggcatcgttttgttaccttaacgtctacgtagttggaatccatgctttacaactttgcttttctactttgata |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308850 |
atatactccaaaacggcatcgttttgttaccttaacgtctacgtagttggaatccatgctttacaactttgcttttctactttgata |
3308764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 3308909 - 3308871
Alignment:
| Q |
1 |
tacataaaaaacatatgctagtttgagtttggatactca |
39 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3308909 |
tacataaaaaacatatgctactttgagtttggatactca |
3308871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 992 times since January 2019
Visitors: 3074