View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0367_low_50 (Length: 219)
Name: NF0367_low_50
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0367_low_50 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 28847412 - 28847525
Alignment:
| Q |
1 |
ctttttgccagtgatttcttcatcatcataactatcatcattgaaataagtcttacattgtgattgatgatgattacgcttcatcttgagaaagtgagat |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28847412 |
ctttttgccagcgatttcttcatcatcataactatcatcattgaaataagcattaccttgtgattgatgatgattacgcttcatcttgagaaagtgagat |
28847511 |
T |
 |
| Q |
101 |
cttcggtgaccacc |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28847512 |
cttcggtgaccacc |
28847525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University