View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0367_low_55 (Length: 205)

Name: NF0367_low_55
Description: NF0367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0367_low_55
NF0367_low_55
[»] chr1 (1 HSPs)
chr1 (1-111)||(36949899-36950006)
[»] chr6 (1 HSPs)
chr6 (27-111)||(10818104-10818188)


Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 36950006 - 36949899
Alignment:
1 ggtggcagaacaatatatgttacatggaatgcctagtagatcagatatgcaacagcttattaatgtcaatagacacatggtatgttttttctcccttccc 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||||| |   ||||||||||||||||||||||||||||||||||||||||||||    
36950006 ggtggcagaaccatatatgttacatggaatgcctagtagatcacatatgcacc---ttattaatgtcaatagacacatggtatgttttttctcccttccc 36949910  T
101 atctatgcccc 111  Q
    |||||||||||    
36949909 atctatgcccc 36949899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 10818104 - 10818188
Alignment:
27 gaatgcctagtagatcagatatgcaacagcttattaatgtcaatagacacatggtatgttttttctcccttcccatctatgcccc 111  Q
    ||||||||||||||||| |||||||||     | |||||||| |||||||||||||||||| |||||||||| ||||| ||||||    
10818104 gaatgcctagtagatcacatatgcaacgtgacaataatgtcactagacacatggtatgtttattctcccttctcatctttgcccc 10818188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1511 times since January 2019
Visitors: 3089