View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0369_low_8 (Length: 263)
Name: NF0369_low_8
Description: NF0369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0369_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 23 - 234
Target Start/End: Complemental strand, 40514998 - 40514787
Alignment:
| Q |
23 |
atgaacattcatgatgaagagtttnnnnnnntggcatatttcatcttatttcttgtgtgcctaataatgataactctcttaattacaattgcctcttatc |
122 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40514998 |
atgaacattcatgatgaagagtttaagaaaatggcttatttcatcttatttcttgtatgcctaataatgataactctcttaattacaattgcctcttatc |
40514899 |
T |
|
| Q |
123 |
tatgtactatacccacttcttcttctactcaacctccttc---tcagcctcttggagtacatgacacaaactccaaccaaaccacaattactgtaatgga |
219 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40514898 |
tatgtactatacccacttc---ttctactcaacctccttctcatcagcctcttggagtacatgacacaaactccaaccaaaccacaattactgtaatgga |
40514802 |
T |
|
| Q |
220 |
accagctgatcaaca |
234 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40514801 |
accagctgatcaaca |
40514787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 313 times since January 2019
Visitors: 3059