View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0370_high_30 (Length: 251)
Name: NF0370_high_30
Description: NF0370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0370_high_30 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 29 - 251
Target Start/End: Original strand, 44410060 - 44410284
Alignment:
| Q |
29 |
acatctacaatgtaaacaaatgataagtatttcaatacgtggcaatattatatatatagcactcttttgcattatgattttccaatgtcacattgttata |
128 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44410060 |
acatctacaatgtaaacaaatgacaaatatttcaatacgtggcaatattatatatatagcactcttttgcattatgattttccaatgtcacattgttata |
44410159 |
T |
|
| Q |
129 |
nnnnnnnnnnnnnnnnnnnnnnnaactc--tactataaaagcaatattaattgttaaagaccaccctaataaagcaaaatttcaaaatttcttatttcaa |
226 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44410160 |
tttttcttttcttttctgattttaactctatactataaaagcaatattaattgttaaaggccaccctaataaagcaaaatttcaaaatttcttatttcaa |
44410259 |
T |
|
| Q |
227 |
taaaatgaaattcaataaattccac |
251 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44410260 |
taaaatgaaattcaataaattccac |
44410284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1969 times since January 2019
Visitors: 3095