View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0370_high_39 (Length: 210)
Name: NF0370_high_39
Description: NF0370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0370_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 39292717 - 39292782
Alignment:
Q |
24 |
tattgcaactagttatatagatctcgaacaagatttacggtagaagaagatggaaaagaatagtag |
89 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
39292717 |
tattgcaactagttataaagatctcgaacaagatttacggtagaagaagaaggaaaagaatagtag |
39292782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1458 times since January 2019
Visitors: 3084