View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0370_low_18 (Length: 371)
Name: NF0370_low_18
Description: NF0370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0370_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 305; Significance: 1e-171; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 1 - 340
Target Start/End: Original strand, 33112292 - 33112634
Alignment:
| Q |
1 |
ccgagttttaaaactatgcaaatatgaccccaatctctcaacattagtatcactttgttttgtctgactttgtggaaatcattcatcgctgtctcattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33112292 |
ccgagttttaaaactatgcaaatatgaccccaatctctcaacattagtatcactttgttttgtctgactttgtggaaatcattcatcgctctctcattat |
33112391 |
T |
 |
| Q |
101 |
atataaatattttgcatatgatccaaacggtggtttgtttctcaatttccaaagaaccaattcacc---accaccacctcaacctctttcacaatggaag |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
33112392 |
atataaatattttgcatatgatccaaacggtggtttgtttctcaatttccaaagaaccaattcaccacaaccaccacctcaacctctttcaaaatggaag |
33112491 |
T |
 |
| Q |
198 |
gtggagtacataagcctgatatctcagcttttagagaatgtctttccctttcatggaaaaatccttatgtccttcgtcttgctttttctgctggtattgg |
297 |
Q |
| |
|
||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33112492 |
gtgaagtacataagcctgatatatcagcttttagagaatgtctttccctttcatggaaaaatccttatgtccttcgtcttgctttttctgctggtattgg |
33112591 |
T |
 |
| Q |
298 |
tggctttctctttggctacgatactggtaattacactacaacc |
340 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33112592 |
tggccttctctttggctacgacactggtaattacactacaacc |
33112634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 264 - 312
Target Start/End: Original strand, 33110888 - 33110936
Alignment:
| Q |
264 |
atgtccttcgtcttgctttttctgctggtattggtggctttctctttgg |
312 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
33110888 |
atgtccttcgacttgctttctctgctggtattggtggccttctctttgg |
33110936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 191 - 238
Target Start/End: Original strand, 33110829 - 33110876
Alignment:
| Q |
191 |
atggaaggtggagtacataagcctgatatctcagcttttagagaatgt |
238 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
33110829 |
atggaaggtggagtaccagaggctgatatctcagcttttagagaatgt |
33110876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 67; Significance: 1e-29; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 190 - 328
Target Start/End: Complemental strand, 21562911 - 21562773
Alignment:
| Q |
190 |
aatggaaggtggagtacataagcctgatatctcagcttttagagaatgtctttccctttcatggaaaaatccttatgtccttcgtcttgctttttctgct |
289 |
Q |
| |
|
||||||||| ||||||| | | ||||| | || ||||| ||||||||| | || || |||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
21562911 |
aatggaaggaggagtacctgaagctgatgtatctgctttcagagaatgtttgtctctatcatggaaaaatccttatgttcttcgtcttgctttctctgct |
21562812 |
T |
 |
| Q |
290 |
ggtattggtggctttctctttggctacgatactggtaat |
328 |
Q |
| |
|
|| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
21562811 |
ggaattggtggttttctctttggctatgatactggtaat |
21562773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 215 - 327
Target Start/End: Complemental strand, 21496836 - 21496724
Alignment:
| Q |
215 |
gatatctcagcttttagagaatgtctttccctttcatggaaaaatccttatgtccttcgtcttgctttttctgctggtattggtggctttctctttggct |
314 |
Q |
| |
|
||||| || ||||| ||||||||| | || || |||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| ||||||| |
|
|
| T |
21496836 |
gatatgtctgctttcagagaatgtttatctctatcatggaaaaatccttatgttcttcgtcttgctttttctgctggaattggtggccttctttttggct |
21496737 |
T |
 |
| Q |
315 |
acgatactggtaa |
327 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
21496736 |
atgatactggtaa |
21496724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 248 - 317
Target Start/End: Original strand, 51032218 - 51032287
Alignment:
| Q |
248 |
tcatggaaaaatccttatgtccttcgtcttgctttttctgctggtattggtggctttctctttggctacg |
317 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||| |||||||||| |
|
|
| T |
51032218 |
tcatggaaaaatccttatgttcttcgtcttgctttttctgctggaattggtggacttctttttggctacg |
51032287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University