View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0370_low_39 (Length: 251)
Name: NF0370_low_39
Description: NF0370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0370_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 889753 - 889517
Alignment:
| Q |
1 |
atttttgaattctcaaatatgtcaaaaatacactatcgaaagtgcgttttcgatattgtattttcaaagtgtacttctcgtaagtaagtcgacggagaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
889753 |
atttttgaattctcaaatatgtcaaaaatacactatcgaaagtgcattttcgatattgtattttcaaagtgtactttccgtaagt----cgacggagaga |
889658 |
T |
 |
| Q |
101 |
ct-gagaaataatctaatgataagacctatcaagtagtagtgttgtttttcattttaccacttgcatgtgtgtctatatatat----gtgtgtgtgaaga |
195 |
Q |
| |
|
|| ||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
889657 |
ctagagaaataatctaatcataagacctact------tagtgttgtttttcattttaccacttgcatgtgtgtctatatatatatatgtgtgtgtgaaga |
889564 |
T |
 |
| Q |
196 |
gagatacaaagagatatcacaattattcttctcagtccctctctgtg |
242 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
889563 |
gagatgcaaagagatatcacaattattcttctcagtccctctctgtg |
889517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University