View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0372_low_4 (Length: 411)
Name: NF0372_low_4
Description: NF0372
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0372_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 52 - 400
Target Start/End: Original strand, 51114325 - 51114683
Alignment:
| Q |
52 |
atggtcttctttggttggaattggaaaggtaacaatttagttaagcattcaagctcggtttttattttgattcaacttgcaagctgtaaattttggctat |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51114325 |
atggtcttctttggttggaattggaaaggtaacaatttagttaagcattcaagctcggtttttattttgattcaacttgcaagctgtaaattttggctat |
51114424 |
T |
|
| Q |
152 |
ggtttggtgttaatattattctagtacaaatttaattcttgattatctctttcnnnnnnnagatatctgagaaaatattctgctaattattcatgtccat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51114425 |
ggtttggtgttaatattattctagtacaaatttaattcttgattatctctttctttttttagatatctgagaaaatattctgcaaattattcatgtccat |
51114524 |
T |
|
| Q |
252 |
tggtgtttgaaccttatttatgtgttggattagaagttagatagaatgcatgcttgaaa----------tgtagttcatttcacacggcaaataaggtac |
341 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
51114525 |
tggtgtttgaaccttatttatttgttggattagaagttagatagaatgcatgcttgaaatgtgtatgtctgtagttcatttcacacggcaaataagatac |
51114624 |
T |
|
| Q |
342 |
aaaacaaaatgaaacctacattaaaatgtgacatcggagtgtgttcttctcaagtctct |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51114625 |
aaaacaaaatgaaacctacattaaaatgtgacatcggagtgtgttcttctcaagtctct |
51114683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 6e-16; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 53 - 136
Target Start/End: Complemental strand, 546450 - 546367
Alignment:
| Q |
53 |
tggtcttctttggttggaattggaaaggtaacaatttagttaagcattcaagctcggtttttattttgattcaacttgcaagct |
136 |
Q |
| |
|
||||||||||| | |||||||||||| |||||||||||| |||| ||||||| | | ||||||||||||||||||||||||| |
|
|
| T |
546450 |
tggtcttctttagaaagaattggaaaggaaacaatttagtttagcagtcaagcttgatctttattttgattcaacttgcaagct |
546367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 148 - 204
Target Start/End: Complemental strand, 552621 - 552568
Alignment:
| Q |
148 |
ctatggtttggtgttaatattattctagtacaaatttaattcttgattatctctttc |
204 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
552621 |
ctatggtttggtgttaatattattc---tgcaaatttaattcttgattgtctctttc |
552568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 55 - 93
Target Start/End: Original strand, 1553995 - 1554033
Alignment:
| Q |
55 |
gtcttctttggttggaattggaaaggtaacaatttagtt |
93 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
1553995 |
gtcttctttggttggaattggaaagattacaatttagtt |
1554033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 526 times since January 2019
Visitors: 3060