View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0373_low_6 (Length: 289)
Name: NF0373_low_6
Description: NF0373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0373_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 9e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 77 - 152
Target Start/End: Complemental strand, 3908688 - 3908613
Alignment:
| Q |
77 |
gagaagaattacttgatggtgttgaggatgatggagttttggctttctttcccttacgacaaccaccaccaatagg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3908688 |
gagaagaattacttgatggtgttgaggatgatggagttttggatttctttcccttacgacaaccaccaccaatagg |
3908613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1215 times since January 2019
Visitors: 3078