View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0373_low_7 (Length: 261)
Name: NF0373_low_7
Description: NF0373
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0373_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 20 - 72
Target Start/End: Original strand, 24038859 - 24038911
Alignment:
Q |
20 |
tgatatgaattatgtattgtatgaatttgaaatttcctttaattagattagtc |
72 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
24038859 |
tgatatgaattatgtattgtatgaatttgaaatttcctttaattatattagtc |
24038911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University