View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0374_high_14 (Length: 301)
Name: NF0374_high_14
Description: NF0374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0374_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 131 - 222
Target Start/End: Complemental strand, 40511954 - 40511863
Alignment:
Q |
131 |
gtctcaaataatcacttaatcagtaatgatttctcacctaagtatacttgttttccacaatccctgcagaaaaacgaaaacagagtggattc |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40511954 |
gtctcaaataatcacttaatcagtaatgatttctcacctaagtatacttgttttccacaatccctgcagaaaaacgaaaacagagtggattc |
40511863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 22122404 - 22122448
Alignment:
Q |
16 |
atgaaaattaccttgccgcagcatgcgcggtatcaaatccacctg |
60 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22122404 |
atgaaaattaccttgccgcagcatgcgcggtatcaaatccacctg |
22122448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 16 - 60
Target Start/End: Complemental strand, 40512069 - 40512025
Alignment:
Q |
16 |
atgaaaattaccttgccgcagcatgcgcggtatcaaatccacctg |
60 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40512069 |
atgaaaattaccttgccgcagcatgcgcggtatcaaatccacctg |
40512025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University