View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0374_high_17 (Length: 275)
Name: NF0374_high_17
Description: NF0374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0374_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 30 - 225
Target Start/End: Original strand, 4121172 - 4121367
Alignment:
Q |
30 |
gagcagagacgcgaaggtttgaaattgtgggggcagtcacaagactgccaactagcaataacacctgatctttgatattgaggaaaattgtggaaaaatg |
129 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4121172 |
gagcagagacgtgaaggtttgaaattgtgggggcagtcacaagactgccaactagcaataacacctgatctttgatattgaggaaaattgtggaaaaatg |
4121271 |
T |
 |
Q |
130 |
tagttgatgccacacaattgcaattgttgtgatgtggtggtcccaaactctgacattgtggctacaatcgcagtcacggagtacaattcaaaaatt |
225 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4121272 |
tagttgatgccacacaattgcaattgttgtgatgtggtggtcccaaactctgacattgtggctacaatcgcagtcacggagtacaattcaaaaatt |
4121367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 167
Target Start/End: Complemental strand, 4364075 - 4364004
Alignment:
Q |
96 |
gatctttgatattgaggaaaattgtggaaaaatgtagttgatgccacacaattgcaattgttgtgatgtggt |
167 |
Q |
|
|
|||||||||| || ||||||| || |||||||| |||||||| ||||||||| |||||||||||||||| |
|
|
T |
4364075 |
gatctttgatgttaaggaaaactgaagaaaaatgaggttgatgcgacacaattgtgattgttgtgatgtggt |
4364004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University